Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

L_EGFP_AC
(Plasmid #185971)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 185971 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Pz
  • Backbone manufacturer
    expressys.
  • Backbone size w/o insert (bp) 1720
  • Total vector size (bp) 3199
  • Modifications to backbone
    Insertion of PlLacO-1 EGFP
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Pl-LacO1-Egfp
  • Species
    Synthetic
  • Insert Size (bp)
    1475
  • Promoter PlLacO-1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AatII (not destroyed)
  • 3′ cloning site AvrII (not destroyed)
  • 5′ sequencing primer GTTTTGGAGCACGGAAAGAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    L_EGFP_AC was a gift from Sangram Bagh (Addgene plasmid # 185971 ; http://n2t.net/addgene:185971 ; RRID:Addgene_185971)
  • For your References section:

    A microgravity responsive synthetic genetic device in Escherichia coli. Mukhopadhyay S, Bagh S. Biosens Bioelectron. 2020 Nov 1;167:112462. doi: 10.1016/j.bios.2020.112462. Epub 2020 Aug 1. 10.1016/j.bios.2020.112462 PubMed 32781386
Commonly requested with: