Skip to main content
Addgene

pNB_EA_R3tdTomatoi2
(Plasmid #185969)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 185969 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Pz
  • Backbone manufacturer
    expressys.
  • Backbone size w/o insert (bp) 1856
  • Total vector size (bp) 3693
  • Modifications to backbone
    Insertion of Pr i2 tdTomato cassette in reverse direction in network brick
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Pr-i2rbs-tdTomato cassette in reverse direction in Network Brick
  • Species
    Synthetic
  • Insert Size (bp)
    1102
  • Promoter PR

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AatII (unknown if destroyed)
  • 3′ cloning site PciI (unknown if destroyed)
  • 5′ sequencing primer TACTGGGACGAAGACGAACA
  • 3′ sequencing primer GTTGTTTTGGAGCACGGAAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNB_EA_R3tdTomatoi2 was a gift from Sangram Bagh (Addgene plasmid # 185969 ; http://n2t.net/addgene:185969 ; RRID:Addgene_185969)
  • For your References section:

    Processing two environmental chemical signals with a synthetic genetic IMPLY gate, a 2-input-2-output integrated logic circuit, and a process pipeline to optimize its systems chemistry in Escherichia coli. Mukhopadhyay S, Sarkar K, Srivastava R, Pal A, Bagh S. Biotechnol Bioeng. 2020 May;117(5):1502-1512. doi: 10.1002/bit.27286. Epub 2020 Feb 7. 10.1002/bit.27286 PubMed 31981217