pET-His6-Sumo-CylK-Strep
(Plasmid
#185962)
-
PurposeExpresses His6-Sumo-CylK-Strep in E. coli for refolding protein preparation
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 185962 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneAdgene 29711
- Backbone size w/o insert (bp) 4466
- Total vector size (bp) 7069
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCylK
-
SpeciesCylindrospermum licheniforme
-
Insert Size (bp)2403
-
GenBank IDARU81125.1
- Promoter T7
-
Tag
/ Fusion Protein
- His6-Sumo (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGAAGCGTTCGCTAAAAGACAGG
- 3′ sequencing primer T7 Terminator (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-His6-Sumo-CylK-Strep was a gift from Emily Balskus (Addgene plasmid # 185962 ; http://n2t.net/addgene:185962 ; RRID:Addgene_185962) -
For your References section:
Structural basis for an unprecedented enzymatic alkylation in cylindrocyclophane biosynthesis. Braffman NR, Ruskoski TB, Davis KM, Glasser NR, Johnson C, Okafor CD, Boal AK, Balskus EP. Elife. 2022 Feb 25;11. pii: 75761. doi: 10.7554/eLife.75761. 10.7554/eLife.75761 PubMed 35212625