-
PurposeA soluble photostable fluorescent marker of the mitochondrial matrix. The StayGold gene has codon optimization for mammalian expression.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 185823 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCSII-EF
-
Backbone manufacturerDr. Hiroyuki Miyoshi
- Backbone size w/o insert (bp) 9133
- Total vector size (bp) 10036
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemt-(n1)StayGold
-
SpeciesSynthetic
-
Insert Size (bp)903
-
GenBank ID
- Promoter EF1a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer GGTTCATTCTCAAGCCTCAGAC
- 3′ sequencing primer GCAGCGTATCCACATAGCG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCSII-EF/mt-(n1)StayGold was a gift from Atsushi Miyawaki (Addgene plasmid # 185823 ; http://n2t.net/addgene:185823 ; RRID:Addgene_185823) -
For your References section:
A highly photostable and bright green fluorescent protein. Hirano M, Ando R, Shimozono S, Sugiyama M, Takeda N, Kurokawa H, Deguchi R, Endo K, Haga K, Takai-Todaka R, Inaura S, Matsumura Y, Hama H, Okada Y, Fujiwara T, Morimoto T, Katayama K, Miyawaki A. Nat Biotechnol. 2022 Apr 25. pii: 10.1038/s41587-022-01278-2. doi: 10.1038/s41587-022-01278-2. 10.1038/s41587-022-01278-2 PubMed 35468954