Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

ubc-nls-pcp-12xSunTag (SRv1.2)
(Plasmid #185799)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 185799 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pHAGE-UbiC
  • Total vector size (bp) 7604
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    pcp-12xSunTag
  • Species
    Synthetic
  • Promoter human ubiquitin C promoter
  • Tags / Fusion Proteins
    • NLS (N terminal on insert)
    • HA (N terminal on insert)
    • FactorXa site (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer hUBCpro-F2 CGCCGATGATTATATAAGGA
  • 3′ sequencing primer ACCGGTGCGCGCTCGATG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ubc-nls-pcp-12xSunTag (SRv1.2) was a gift from Robin Lee (Addgene plasmid # 185799 ; http://n2t.net/addgene:185799 ; RRID:Addgene_185799)
  • For your References section:

    Long-term imaging of individual mRNA molecules in living cells. Guo Y, Lee REC. Cell Rep Methods. 2022 May 25;2(6):100226. doi: 10.1016/j.crmeth.2022.100226. eCollection 2022 Jun 20. 10.1016/j.crmeth.2022.100226 PubMed 35784652