cmv-mCherry-8xPP7
(Plasmid
#185795)
-
PurposemCherry labeled with 8xPP7
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 185795 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepKAN
- Backbone size w/o insert (bp) 4719
- Total vector size (bp) 6424
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namecmv-mCherry-8xPP7
-
SpeciesSynthetic
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer T7
- 3′ sequencing primer AGATCTGCCATTTGTCTCGAGGTCGAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
cmv-mCherry-8xPP7 was a gift from Robin Lee (Addgene plasmid # 185795 ; http://n2t.net/addgene:185795 ; RRID:Addgene_185795) -
For your References section:
Long-term imaging of individual mRNA molecules in living cells. Guo Y, Lee REC. Cell Rep Methods. 2022 May 25;2(6):100226. doi: 10.1016/j.crmeth.2022.100226. eCollection 2022 Jun 20. 10.1016/j.crmeth.2022.100226 PubMed 35784652
