pUb-HisUb-Ubc9-ChE1 v4.5
(Plasmid #185756)

• Purpose: Bacterial expression of His-Ub, Ubc9 and ChE1 v4.5
• Depositing Lab: Jeffrey Bode
• Publication: Akimoto et al ACS Cent Sci. 2022 Feb 23;8(2):275-281. doi: 10.1021/acscentsci.1c01490. Epub 2022 Feb 9.

Backbone

• Vector backbone: pSUMO1

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: His-Ub
• Insert Size (bp): 312
• Promoter: T7
• Tag / Fusion Protein:
  • His6 (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: aggagatataccatgggcagc

Gene/Insert 2

• Gene/Insert name: Ubc9
• Species: H. sapiens (human)
• Insert Size (bp): 474
• Mutation: K14R
• Promoter: T7

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: aagaaggagatatacatatgtcc

Gene/Insert 3

• Gene/Insert name: ChE1 v4.5
• Insert Size (bp): 3051
• Promoter: T7

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gaaggagatatacatatggcc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry