p221-RV-dlx-dio-Tdtomato
(Plasmid #185697)

• Purpose: Retroviral vector expression cre-dependent membrane tagged Tdtomato driven by the mDlx promoter
• Depositing Lab: Lynette Lim
• Publication: AAV vector using mDlx promoter (unpublished)

Backbone

• Vector backbone: addgene 87665
• Backbone manufacturer: addgene
• Backbone size w/o insert (bp): 6857
• Total vector size (bp): 846
• Modifications to backbone: Remove CAG promoter, replace with mDlx promoter
• Vector type: Retroviral, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: membrane Tdtomato
• Alt name: Tdt
• Alt name: mTdt
• Species: Synthetic
• Promoter: mDlx
• Tag / Fusion Protein:
  • Gap43 palmitoylation (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: AACCTCCTCGTTCGACCCCGCC

Resource Information

• Supplemental Documents:
  • p221-rv-dlx-dio-mtdt.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry