Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCAGGS SARS-CoV-2 D614G Spike
(Plasmid #185692)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 185692 Standard format: Plasmid sent in bacteria as agar stab 1 $85 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pCAGGS
  • Backbone size w/o insert (bp) 4717
  • Total vector size (bp) 8528
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SARS-CoV-2 D614G Spike
  • Alt name
    SARS-CoV-2 Spike
  • Mutation
    Contains the following mutation: D614G
  • Entrez Gene
    S (a.k.a. GU280_gp02, spike glycoprotein)
  • Promoter chicken β-actin promoter, CMV enhancer

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer CTCTAGAGCCTCTGCTAACCATGTTC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAGGS SARS-CoV-2 D614G Spike was a gift from Marceline Côté (Addgene plasmid # 185692 ; http://n2t.net/addgene:185692 ; RRID:Addgene_185692)
  • For your References section:

    Identification and differential usage of a host metalloproteinase entry pathway by SARS-CoV-2 Delta and Omicron. Benlarbi M, Laroche G, Fink C, Fu K, Mulloy RP, Phan A, Ariana A, Stewart CM, Prevost J, Beaudoin-Bussieres G, Daniel R, Bo Y, El Ferri O, Yockell-Lelievre J, Stanford WL, Giguere PM, Mubareka S, Finzi A, Dekaban GA, Dikeakos JD, Cote M. iScience. 2022 Nov 18;25(11):105316. doi: 10.1016/j.isci.2022.105316. Epub 2022 Oct 10. 10.1016/j.isci.2022.105316 PubMed 36254158