Skip to main content
Addgene

pTW037
(Plasmid #185688)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 185688 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pTRANS_250d
  • Vector type
    Plant Expression, CRISPR
  • Selectable markers
    Hygromycin ; Firefly Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cas9, Drm1b gRNA
  • gRNA/shRNA sequence
    gtgtatggacgacgatatca
  • Species
    Setaria viridis

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer n/a
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTW037 was a gift from Feng Zhang (Addgene plasmid # 185688 ; http://n2t.net/addgene:185688 ; RRID:Addgene_185688)
  • For your References section:

    Optimization of multiplexed CRISPR/Cas9 system for highly efficient genome editing in Setaria viridis. Weiss T, Wang C, Kang X, Zhao H, Elena Gamo M, Starker CG, Crisp PA, Zhou P, Springer NM, Voytas DF, Zhang F. Plant J. 2020 Nov;104(3):828-838. doi: 10.1111/tpj.14949. Epub 2020 Sep 8. 10.1111/tpj.14949 PubMed 32786122