Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pPW3754 : pUC-SpCas9_gRNA-HsIRE1-Cterm
(Plasmid #185676)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 185676 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pUC
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ERN1 gRNA
  • Alt name
    IRE1alpha
  • Alt name
    IRE1a
  • gRNA/shRNA sequence
    CTGGGGCCACCAGAACAGAG
  • Species
    H. sapiens (human)
  • Entrez Gene
    ERN1 (a.k.a. IRE1, IRE1P, IRE1a, hIRE1p)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPW3754 : pUC-SpCas9_gRNA-HsIRE1-Cterm was a gift from Peter Walter (Addgene plasmid # 185676 ; http://n2t.net/addgene:185676 ; RRID:Addgene_185676)
  • For your References section:

    Endoplasmic reticulum stress activates human IRE1alpha through reversible assembly of inactive dimers into small oligomers. Belyy V, Zuazo-Gaztelu I, Alamban A, Ashkenazi A, Walter P. Elife. 2022 Jun 22;11:e74342. doi: 10.7554/eLife.74342. 10.7554/eLife.74342 PubMed 35730415