pJET-CMV-GFP-P2A-I15-P2A-mCherry
(Plasmid
#185620)
-
PurposeRibosomal stalling reporter: 15x isoleucine
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 185620 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepJET1.2
-
Backbone manufacturerThermo Scientific
- Backbone size w/o insert (bp) 3000
- Total vector size (bp) 6177
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP-I15-mCherry
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3100
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer cgactcactatagggagagcggc
- 3′ sequencing primer aagaacatcgattttccatggcag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byBased on: Addgene #105686
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJET-CMV-GFP-P2A-I15-P2A-mCherry was a gift from Sabine Fuchs (Addgene plasmid # 185620 ; http://n2t.net/addgene:185620 ; RRID:Addgene_185620) -
For your References section:
Isoleucine-to-valine substitutions support cellular physiology during isoleucine deprivation. Kok G, Schene IF, Ilcken EF, Alcaraz PS, Mendes MI, Smith DEC, Salomons G, Shehata S, Jans JJM, Maroofian R, Hoek TA, van Es RM, Rehmann H, Nieuwenhuis EES, Vos HR, Fuchs SA. Nucleic Acids Res. 2025 Jan 7;53(1):gkae1184. doi: 10.1093/nar/gkae1184. 10.1093/nar/gkae1184 PubMed 39657787