CAG-rtTA
(Plasmid
#185562)
-
PurposeUbiquitous expression of reverse tetracycline transactivator for TetON system
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 185562 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepCAGEN
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namertTA
- Promoter CAG
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gacggtaccgcgggcccgggatccaatgtctagactggacaagagcaaagt
- 3′ sequencing primer taggcagcctgcacctgaggagtgcttacccggggagcatgtcaag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CAG-rtTA was a gift from Connie Cepko (Addgene plasmid # 185562 ; http://n2t.net/addgene:185562 ; RRID:Addgene_185562) -
For your References section:
Retinoic acid signaling mediates peripheral cone photoreceptor survival in a mouse model of retina degeneration. Amamoto R, Wallick GK, Cepko CL. Elife. 2022 Mar 22;11. pii: 76389. doi: 10.7554/eLife.76389. 10.7554/eLife.76389 PubMed 35315776
