pLV-GG-hUbC-EBPF2-gRNA-HHIP
(Plasmid
#185551)
-
PurposeLentiviral backbone with EBFP2 reporter and gRNA targeting HHIP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 185551 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLV
- Backbone size w/o insert (bp) 10451
- Total vector size (bp) 11493
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersEBFP2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHHIP gRNAs
-
gRNA/shRNA sequenceCTTCTTTTTAACTAGCGCGC; GCGAGAAGCGGTGACGTCAA; TGTTCACTTGTCCGTGTAAC; AGGAACAGAAACGGCGACGG
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CAGCACAAAAGGAAACTCACC; GAGGGCCTATTTCCCATGATT; TCGCTATGTGTTCTGGGAAA; cctgctgaagctctagtac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThis plasmid was adapted from pLV GG hUbC-dsRED from Charles Gersbach lab. We modified the plasmid to express an EBFP2 reporter (pLV GG hUbC-EBFP2). We then cloned in HHIP-targeting gRNA
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV-GG-hUbC-EBPF2-gRNA-HHIP was a gift from Andrew Wilson (Addgene plasmid # 185551 ; http://n2t.net/addgene:185551 ; RRID:Addgene_185551) -
For your References section:
CRISPR interference interrogation of COPD GWAS genes reveals the functional significance of desmoplakin in iPSC-derived alveolar epithelial cells. Werder RB, Liu T, Abo KM, Lindstrom-Vautrin J, Villacorta-Martin C, Huang J, Hinds A, Boyer N, Bullitt E, Liesa M, Silverman EK, Kotton DN, Cho MH, Zhou X, Wilson AA. Sci Adv. 2022 Jul 15;8(28):eabo6566. doi: 10.1126/sciadv.abo6566. Epub 2022 Jul 13. 10.1126/sciadv.abo6566 PubMed 35857525