fluoPEER-GFP>BFP
(Plasmid #185477)

• Purpose: Fluorescent reporter for a Y66H mutation to convert a GFP to BFP.
• Depositing Lab: Sabine Fuchs
• Publication: Schene et al Nat Commun. 2022 Mar 1;13(1):1028. doi: 10.1038/s41467-022-28656-3.

Backbone

• Vector backbone: pmGFP-P2A-K0-P2A-RFP
• Backbone manufacturer: Ramanujan Hegde
• Backbone size w/o insert (bp): 5964
• Total vector size (bp): 5986
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GFP-Y66-editing-site
• Species: Synthetic
• Insert Size (bp): 46
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: Acc65I (not destroyed)
• 5′ sequencing primer: atgtggcgattctacacagaag
• 3′ sequencing primer: ttggtcaccttcagcttgg

Resource Information

• Supplemental Documents:
  • fluoPEER_GFP>BFP.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The reporter can be used in combination with pegRNA-GFP>BFP_Y66H-NGG with any type of prime editor. This pegRNA does not edit the human genome, therefore the combination of this reporter and the corresponding pegRNA can be cotransfected with your own pegRNA of interest to enrich for prime edited cells. Editing on the reporter will result in mCherry fluorescence.