fluoPEER-HEK3_5bp-del
(Plasmid #185476)

• Purpose: Fluorescent reporter for a 5 basepair deletion at the HEK3 locus.
• Depositing Lab: Sabine Fuchs
• Publication: Schene et al Nat Commun. 2022 Mar 1;13(1):1028. doi: 10.1038/s41467-022-28656-3.

Backbone

• Vector backbone: pmGFP-P2A-K0-P2A-RFP
• Backbone manufacturer: Ramanujan Hegde
• Backbone size w/o insert (bp): 5964
• Total vector size (bp): 5999
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: HEK3 editing site
• Species: H. sapiens (human)
• Insert Size (bp): 59
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: Acc65I (not destroyed)
• 5′ sequencing primer: atgtggcgattctacacagaag
• 3′ sequencing primer: ttggtcaccttcagcttgg

Resource Information

• Supplemental Documents:
  • fluoPEER-HEK3_5bp-del.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The reporter can be used in combination with pegRNA-HEK3_del1-5-NGG with any type of prime editor, which will also edit the HEK3 locus on the human genome. Editing on the reporter will result in mCherry fluorescence.