pET21a(+)_co_L-HicDH
(Plasmid #185453)

• Purpose: CDS of L-HicDH codon optimized for expression in Synechocystis sp. PCC 6803 in pET21a(+).
• Depositing Lab: Wolfgang Kroutil
• Publication: Jurkaš et al Engineering Microbiology, 2022

Backbone

• Vector backbone: pET21a(+)
• Backbone size w/o insert (bp): 5367
• Total vector size (bp): 6297
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: Room Temperature
• Growth Strain(s): NEB Stable
• Growth instructions: see additional file or original article
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: L-HicDH from Lactobacillus confusus DSM 20196
• Alt name: hydroxyisocaproate dehydrogenase from Lactobacillus confusus DSM 20196
• Species: Lactobacillus confusus DSM 20196
• Insert Size (bp): 957
• GenBank ID: M31425
• Promoter: T7

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: Xhol (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: TGCTAGTTATTGCTCAGCGG

Resource Information

• Supplemental Documents:
  • pJUV_17.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry