pBig1a zz TEV YBBR TPP1 MBP TEV TIN2
(Plasmid #185446)

• Purpose: Coexpresses human TPP1 with a zz affinity tag, YBBR labeling site, and TEV cleavage site and human TIN2 with an MBP affinity tag and TEV cleavage site in insect cells
• Depositing Lab: Ahmet Yildiz
• Publication: Jack et al Dev Cell. 2022 Jan 24;57(2):277-290.e9. doi: 10.1016/j.devcel.2021.12.017.

Backbone

• Vector backbone: pBig1a
• Backbone size w/o insert (bp): 6500
• Total vector size (bp): 11194
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin and Streptomycin, 100 & 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: TPP1
• Species: H. sapiens (human)
• Insert Size (bp): 1370
• GenBank ID: AAX82621.1
• Entrez Gene: TPP1 (a.k.a. CLN2, GIG1, LPIC, SCAR7, TPP-1)
• Tags / Fusion Proteins:
  • ZZ (N terminal on insert)
  • YBBR (N terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CTGGTCATTCTCAGAGATGC
• 3′ sequencing primer: GAAATGCGGGAGGACCAGGA

Gene/Insert 2

• Gene/Insert name: TIN2
• Species: H. sapiens (human)
• Insert Size (bp): 1059
• GenBank ID: NM_012461.3
• Entrez Gene: TINF2 (a.k.a. DKCA3, TIN2)
• Tag / Fusion Protein:
  • MBP (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCT ACG CCC CTG GTG GCG GG
• 3′ sequencing primer: CTA AAG GGA AAC AGC ATG AC

Resource Information

• Supplemental Documents:
  • pbig1a-zz-tev-ybbr-tpp1_his-mbp-tev-tin2.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry