pAAV-EFS-DIO-GRAB_OT1.0
(Plasmid
#185387)
-
PurposeExpresses the genetically-encoded fluorescent oxytocin(OT) sensor GRAB_OT1.0 in a cre-dependent manner
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 185387 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4322
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGPCR activation based oxytocin sensor GRAB_OT1.0
-
SpeciesB. taurus (bovine)
-
Insert Size (bp)1983
- Promoter EFS
Cloning Information
- Cloning method Gibson Cloning
- 3′ sequencing primer GGAGGAGAAAATGAAAGCCA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.02.10.480016v1.full for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-EFS-DIO-GRAB_OT1.0 was a gift from Yulong Li (Addgene plasmid # 185387 ; http://n2t.net/addgene:185387 ; RRID:Addgene_185387) -
For your References section:
A genetically encoded sensor measures temporal oxytocin release from different neuronal compartments. Qian T, Wang H, Wang P, Geng L, Mei L, Osakada T, Wang L, Tang Y, Kania A, Grinevich V, Stoop R, Lin D, Luo M, Li Y. Nat Biotechnol. 2023 Jan 2. doi: 10.1038/s41587-022-01561-2. 10.1038/s41587-022-01561-2 PubMed 36593404