pG108-K - AhpC-Glow
(Plasmid
#185135)
-
PurposeBacteroides - Escherichia coli shuttle vector with TetQ and Kanamycin selection markers BS2 is cloned under the Bacteroides thetaiotaomicron ahpC promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 185135 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepH108
- Backbone size w/o insert (bp) 700
-
Vector typeBacterial Expression ; pG106
-
Selectable markerskanamycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameGlow gene
-
Alt nameBS2
-
SpeciesSynthetic
-
Insert Size (bp)400
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site PstI (unknown if destroyed)
- 5′ sequencing primer CTAGGATCCAAGAAGGCAGCTTCACTGGC
- 3′ sequencing primer CGTACTGCAGTCACTCGAGCAGCTTTTCATA (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameBacteroides thetaiotaomicron ahpC promoter
-
SpeciesSynthetic
-
Insert Size (bp)300
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pG108-K - AhpC-Glow was a gift from Janina Lewis (Addgene plasmid # 185135 ; http://n2t.net/addgene:185135 ; RRID:Addgene_185135) -
For your References section:
Sequence and characterization of shuttle vectors for molecular cloning in Porphyromonas, Bacteroides and related bacteria. Jones KR, Belvin BR, Macrina FL, Lewis JP. Mol Oral Microbiol. 2020 Aug;35(4):181-191. doi: 10.1111/omi.12304. Epub 2020 Jul 9. 10.1111/omi.12304 PubMed 32592236