pAIO-Ef1a-PE2-GFP:KCNQ2-C201R_pp
(Plasmid #185061)

• Purpose: Ef1a driven PE2 with pegRNA for editing C201R mutation (including silent PAM mutation) in KCNQ2. See Addgene plasmid #184445
• Depositing Lab: Bobby Koeleman
• Publication: All in one plasmids SCN1A and KCNQ2 mutations (unpublished)

Backbone

• Vector backbone: pLV
• Backbone manufacturer: SignaGen Inc
• Backbone size w/o insert (bp): 15400
• Total vector size (bp): 15400
• Vector type: Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: U6:pegRNA:scaffold:PBS+RT template
• gRNA/shRNA sequence: gRNA:GCAGAATCTGCAGGAAGCAC; PBS+RT: TCCGGAGTCTGCGCTTCCTGCAGATT
• Species: H. sapiens (human)
• Promoter: U6

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: PaqCI (destroyed during cloning)
• 3′ cloning site: PaqCI (destroyed during cloning)
• 5′ sequencing primer: GTGCAGGGGAAAGAATAGTAGACA
• 3′ sequencing primer: AGCGATCTCTGGGTTCTACG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Backbone was generated by Signagen by cloning PE2-P2A-GFP (Addgene #132776) insert in a pLV backbone (#184445). Further addition of PaqCI sites are performed in our lab. In this plasmid, we cloned KCNQ2 pegRNA in the plasmid

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid is based on the pLV-EF1A:PE2-P2A-GFP (#184445). Only additional KCNQ2 pegRNA is cloned in the plasmid.