Skip to main content
Addgene

pLKO.1-Tet-Puro-shMMERVK9c_1
(Plasmid #185022)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 185022 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLKO.1 Tet Puro
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ERV_MMERVK9c
  • gRNA/shRNA sequence
    CCCAGAGGCAGAGAGAAATTT
  • Species
    M. musculus (mouse)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1-Tet-Puro-shMMERVK9c_1 was a gift from Denes Hnisz (Addgene plasmid # 185022 ; http://n2t.net/addgene:185022 ; RRID:Addgene_185022)
  • For your References section:

    Hijacking of transcriptional condensates by endogenous retroviruses. Asimi V, Sampath Kumar A, Niskanen H, Riemenschneider C, Hetzel S, Naderi J, Fasching N, Popitsch N, Du M, Kretzmer H, Smith ZD, Weigert R, Walther M, Mamde S, Meierhofer D, Wittler L, Buschow R, Timmermann B, Cisse II, Ameres SL, Meissner A, Hnisz D. Nat Genet. 2022 Aug;54(8):1238-1247. doi: 10.1038/s41588-022-01132-w. Epub 2022 Jul 21. 10.1038/s41588-022-01132-w PubMed 35864192