pX458-MMERVK9C-del-gRNA2
(Plasmid
#185005)
-
Purposeexpression of gRNA and Cas9 from S. pyogenes with 2A-EGFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 185005 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonePX458
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMMERVK9C-del-gRNA2
-
gRNA/shRNA sequenceACTGTTTTGTCATTCTGTGG
-
SpeciesM. musculus (mouse)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX458-MMERVK9C-del-gRNA2 was a gift from Denes Hnisz (Addgene plasmid # 185005 ; http://n2t.net/addgene:185005 ; RRID:Addgene_185005) -
For your References section:
Hijacking of transcriptional condensates by endogenous retroviruses. Asimi V, Sampath Kumar A, Niskanen H, Riemenschneider C, Hetzel S, Naderi J, Fasching N, Popitsch N, Du M, Kretzmer H, Smith ZD, Weigert R, Walther M, Mamde S, Meierhofer D, Wittler L, Buschow R, Timmermann B, Cisse II, Ameres SL, Meissner A, Hnisz D. Nat Genet. 2022 Aug;54(8):1238-1247. doi: 10.1038/s41588-022-01132-w. Epub 2022 Jul 21. 10.1038/s41588-022-01132-w PubMed 35864192