pSCL.178
(Plasmid
#184999)
-
PurposeExpress -Eco1 FANCF editing ncRNA and gRNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 184999 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepFUGW-H1 (Addgene plasmid #25870)
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEco1: FANCF targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
-
gRNA/shRNA sequenceggaatcccttctgcagcacc
-
SpeciesE. coli
-
MutationFANCF donor, a1/a2 length extended for 27 bp
- Promoter H1
-
Tags
/ Fusion Proteins
- SV40NLS (N terminal on insert)
- SV40NLS (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSCL.178 was a gift from Seth Shipman (Addgene plasmid # 184999 ; http://n2t.net/addgene:184999 ; RRID:Addgene_184999) -
For your References section:
Precise genome editing across kingdoms of life using retron-derived DNA. Lopez SC, Crawford KD, Lear SK, Bhattarai-Kline S, Shipman SL. Nat Chem Biol. 2022 Feb;18(2):199-206. doi: 10.1038/s41589-021-00927-y. Epub 2021 Dec 23. 10.1038/s41589-021-00927-y PubMed 34949838