Skip to main content
Addgene

pSCL.178
(Plasmid #184999)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 184999 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pFUGW-H1 (Addgene plasmid #25870)
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Eco1: FANCF targeting and editing ncRNA-gRNA (a1/a2 length: 27 v1), expressed constitutively from a pol III (H1) promoter
  • gRNA/shRNA sequence
    ggaatcccttctgcagcacc
  • Species
    E. coli
  • Mutation
    FANCF donor, a1/a2 length extended for 27 bp
  • Promoter H1
  • Tags / Fusion Proteins
    • SV40NLS (N terminal on insert)
    • SV40NLS (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSCL.178 was a gift from Seth Shipman (Addgene plasmid # 184999 ; http://n2t.net/addgene:184999 ; RRID:Addgene_184999)
  • For your References section:

    Precise genome editing across kingdoms of life using retron-derived DNA. Lopez SC, Crawford KD, Lear SK, Bhattarai-Kline S, Shipman SL. Nat Chem Biol. 2022 Feb;18(2):199-206. doi: 10.1038/s41589-021-00927-y. Epub 2021 Dec 23. 10.1038/s41589-021-00927-y PubMed 34949838