pAAV-CAG-mTagBFP2-P2A-EGFP
(Plasmid
#184943)
-
PurposeExpresses blue fluorescent protein mTagBFP2 and EGFP in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 184943 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-CAG-EGFP-WPRE
- Backbone size w/o insert (bp) 4723
- Total vector size (bp) 6232
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemTagBFP2-P2A-EGFP
-
SpeciesSynthetic
-
Insert Size (bp)1509
- Promoter CAG
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ggatccggtaccgccaccatgagcgagctgattaagg
- 3′ sequencing primer GCCCCACTTCCCACGTGAACCGGTCGattaagcttgtgccccagtttgc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CAG-mTagBFP2-P2A-EGFP was a gift from Kiryl Piatkevich (Addgene plasmid # 184943 ; http://n2t.net/addgene:184943 ; RRID:Addgene_184943) -
For your References section:
Dual-expression system for blue fluorescent protein optimization. Papadaki S, Wang X, Wang Y, Zhang H, Jia S, Liu S, Yang M, Zhang D, Jia JM, Koster RW, Namikawa K, Piatkevich KD. Sci Rep. 2022 Jun 17;12(1):10190. doi: 10.1038/s41598-022-13214-0. 10.1038/s41598-022-13214-0 PubMed 35715437