Skip to main content
Addgene

pLX_305_Ovalbumin
(Plasmid #184924)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 184924 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pLX_305
  • Backbone manufacturer
    Broad Institute Genetic Perturbation Platform
  • Backbone size w/o insert (bp) 7555
  • Total vector size (bp) 8716
  • Modifications to backbone
    Cloned in Ovalbumin after the PGK promoter.
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Ovalbumin
  • Species
    G. gallus (chicken)
  • Insert Size (bp)
    1161
  • Mutation
    Our vector has an A188T mutation that does not impact SIINFEKL presentation or responses.
  • GenBank ID
    396058
  • Entrez Gene
    OVAL (a.k.a. OVA, SERPINB14)
  • Promoter PGK

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site AgeI (not destroyed)
  • 5′ sequencing primer TAAGTCGGGAAGGTTCCTTGCG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLX_305_Ovalbumin was a gift from Arlene Sharpe (Addgene plasmid # 184924 ; http://n2t.net/addgene:184924 ; RRID:Addgene_184924)

  • For your References section:

    Framework for in vivo T cell screens. Milling LE, Markson SC, Tjokrosurjo Q, Derosia NM, Streeter ISL, Hickok GH, Lemmen AM, Nguyen TH, Prathima P, Fithian W, Schwartz MA, Hacohen N, Doench JG, LaFleur MW, Sharpe AH. J Exp Med. 2024 Apr 1;221(4):e20230699. doi: 10.1084/jem.20230699. Epub 2024 Feb 27. 10.1084/jem.20230699 PubMed 38411617
Related items:
Commonly requested with: