Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEasyG2_mic
(Plasmid #184916)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 184916 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pUC19
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA scaffold
  • gRNA/shRNA sequence
    GTTTTAGAGCTAGAAATAGCAAGTT
  • Species
    Streptococcus pyogenes

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEasyG2_mic was a gift from Jeferson Gross (Addgene plasmid # 184916 ; http://n2t.net/addgene:184916 ; RRID:Addgene_184916)
  • For your References section:

    EasyGuide Plasmids Support in Vivo Assembly of gRNAs for CRISPR/Cas9 Applications in Saccharomyces cerevisiae. Jacobus AP, Barreto JA, de Bem LS, Menegon YA, Fier I, Bueno JGR, Dos Santos LV, Gross J. ACS Synth Biol. 2022 Nov 18;11(11):3886-3891. doi: 10.1021/acssynbio.2c00348. Epub 2022 Oct 18. 10.1021/acssynbio.2c00348 PubMed 36257021