pTOPO-col10a1-KI-donor
(Plasmid
#184874)
-
PurposeDonor template for knock-in of p2a-CreERT2 into the medaka col10a1 locus via CRISPR/Cas9-mediated homology directed repair
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 184874 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCR-bluntII-TOPO
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 3519
- Total vector size (bp) 8217
-
Vector typeCre/Lox, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameCollagen10a1 5' homology arm
-
SpeciesOryzias latipes
-
Insert Size (bp)292
-
GenBank IDNM_001201509.1
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GTAAAACGACGGCCAG
- 3′ sequencing primer GGCGATCCCTGAACATGTCCAT (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameCollagen10a1 3' homology arm
-
SpeciesOryzias latipes
-
Insert Size (bp)215
-
GenBank IDNM_001201509.1
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer CAACTGATTTAAGCTTT
- 3′ sequencing primer GTCATAGCTGTTTCCTG (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namep2a-CreERT2
-
SpeciesSynthetic
-
Insert Size (bp)2040
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer ACAACAAAGGCTTCCTGGAC
- 3′ sequencing primer CTAGTAACGGCCGCCAGTGT (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameMyosin light chain 2 promoter
-
Alt namecmlc2 promoter
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)899
Cloning Information for Gene/Insert 4
- Cloning method Gibson Cloning
- 5′ sequencing primer GTCGCCGTCCAGCTCGACCA
- 3′ sequencing primer TCTGTTGAGCACCTTTTTCTTG (Common Sequencing Primers)
Gene/Insert 5
-
Gene/Insert nameeGFP
-
SpeciesSynthetic
-
Insert Size (bp)718
Cloning Information for Gene/Insert 5
- Cloning method Gibson Cloning
- 5′ sequencing primer TCTGGATCTACGTAATACGACTCA
- 3′ sequencing primer TGCTGGAATCTGAGCACTTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTOPO-col10a1-KI-donor was a gift from Christoph Winkler (Addgene plasmid # 184874 ; http://n2t.net/addgene:184874 ; RRID:Addgene_184874) -
For your References section:
A novel non-disruptive and efficient knock-in allows fate tracing of resident osteoblast progenitors during repair of vertebral lesions in medaka. Hui TW, Winkler C. Development. 2022 May 20. pii: 275483. doi: 10.1242/dev.200238. 10.1242/dev.200238 PubMed 35593425