Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pDropVn
(Plasmid #184873)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 184873 Standard format: Plasmid sent in bacteria as agar stab 1 $85 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    Entry vector
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Gentamicin, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    lacZalpha,ccdB
  • gRNA/shRNA sequence
    and gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttt
  • Species
    E. coli, lambda phage

Cloning Information

  • Cloning method Unknown

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://arxiv.org/pdf/2111.11880.pdf for preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDropVn was a gift from Patrick Sobetzko (Addgene plasmid # 184873 ; http://n2t.net/addgene:184873 ; RRID:Addgene_184873)
  • For your References section:

    A multifunctional system for genome editing and large-scale interspecies gene transfer. Teufel M, Klein CA, Mager M, Sobetzko P. Nat Commun. 2022 Jun 14;13(1):3430. doi: 10.1038/s41467-022-30843-1. 10.1038/s41467-022-30843-1 PubMed 35701417