pRDA_526
(Plasmid
#184859)
-
PurposeLentiviral vector that enables constitutive sgRNA expression. Also encodes Thy1.1 as a marker of transduction.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 184859 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepXPR_071
-
Backbone manufacturerArlene Sharpe's Lab
- Backbone size w/o insert (bp) 7095
- Total vector size (bp) 7463
-
Modifications to backbone(1) Modification of the tracrRNA, (2) modification of the stuffer between BsmBI digest sites, (3) addition of a gRNA capture sequence following the tracrRNA, and (4) replacement of the fluorophore Vex with Thy1.1.
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA cassette
-
gRNA/shRNA sequenceNA
- Promoter Human U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer GTGAATAGAGTTAGGCAGGGATATTCACC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRDA_526 was a gift from Arlene Sharpe (Addgene plasmid # 184859 ; http://n2t.net/addgene:184859 ; RRID:Addgene_184859) -
For your References section:
Framework for in vivo T cell screens. Milling LE, Markson SC, Tjokrosurjo Q, Derosia NM, Streeter ISL, Hickok GH, Lemmen AM, Nguyen TH, Prathima P, Fithian W, Schwartz MA, Hacohen N, Doench JG, LaFleur MW, Sharpe AH. J Exp Med. 2024 Apr 1;221(4):e20230699. doi: 10.1084/jem.20230699. Epub 2024 Feb 27. 10.1084/jem.20230699 PubMed 38411617