pMA5132
(Plasmid
#184858)
-
PurposeRetroviral vector, hygromycin resistance hTFAM expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 184858 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMA5096
-
Backbone manufacturerAlexeyev lab
- Backbone size w/o insert (bp) 6249
- Total vector size (bp) 6969
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTFAM human
-
SpeciesH. sapiens (human)
-
Insert Size (bp)753
- Promoter LTR
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer gtacaccctaagcctccgcc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMA5132 was a gift from Mikhail Alexeyev (Addgene plasmid # 184858 ; http://n2t.net/addgene:184858 ; RRID:Addgene_184858) -
For your References section:
A Method for In Situ Reverse Genetic Analysis of Proteins Involved mtDNA Replication. Kozhukhar N, Spadafora D, Rodriguez YAR, Alexeyev MF. Cells. 2022 Jul 11;11(14). pii: cells11142168. doi: 10.3390/cells11142168. 10.3390/cells11142168 PubMed 35883613