pMA4854
(Plasmid #184849)

• Purpose: Coexpression of PhiC31o recombinase and EGFP
• Depositing Lab: Mikhail Alexeyev
• Publication: Kozhukhar et al Cells. 2022 Jul 11;11(14). pii: cells11142168. doi: 10.3390/cells11142168.

Backbone

• Vector backbone: pMA2008
• Backbone manufacturer: Alexeyev lab
• Backbone size w/o insert (bp): 4064
• Total vector size (bp): 7057
• Modifications to backbone: Insertion of EGFP and PhiC31o genes with their regulatory elements
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: EGFP
• Alt name: GFP
• Species: A. victoria
• Insert Size (bp): 720
• Promoter: RSV

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: acatggattggacgaaccac

Gene/Insert 2

• Gene/Insert name: PhiC31o
• Species: Streptomyces phage φC31
• Insert Size (bp): 1815
• Promoter: CMV

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: caactccgccccattgacgc

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Addgene

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry