P70a-deGFP-sc101-kan
(Plasmid
#184841)
-
PurposeExpression of deGFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 184841 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUA66
- Backbone size w/o insert (bp) 4182
- Total vector size (bp) 4860
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsWhen picking a colony, make sure it expresses GFP. Alternatively, when using KL740 instead of DH5alpha as growth strain, grow at 29°C.
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namegreen fluorescent protein
-
Alt namedeGFP
-
SpeciesSynthetic
- Promoter promoter OR2-OR1
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TATCACGAGGCCCTTTCGTC
- 3′ sequencing primer GTTGAAGGCTCTCAAGGGCA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
P70a-deGFP-sc101-kan was a gift from Chase Beisel (Addgene plasmid # 184841 ; http://n2t.net/addgene:184841 ; RRID:Addgene_184841) -
For your References section:
Anti-CRISPR prediction using deep learning reveals an inhibitor of Cas13b nucleases. Wandera KG, Alkhnbashi OS, Bassett HVI, Mitrofanov A, Hauns S, Migur A, Backofen R, Beisel CL. Mol Cell. 2022 May 24. pii: S1097-2765(22)00437-3. doi: 10.1016/j.molcel.2022.05.003. 10.1016/j.molcel.2022.05.003 PubMed 35649413