Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSN840
(Plasmid #184832)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 184832 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pACEBac1, pIDS
  • Backbone manufacturer
    GENEVA Biotech
  • Backbone size w/o insert (bp) 5944
  • Total vector size (bp) 10735
  • Modifications to backbone
    Generated by Cre-LoxP recombination of pACEBac1 and pIDS
  • Vector type
    Insect Expression, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Gentamicin, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    KIF5A (∆exon27)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3111
  • Mutation
    ∆exon27 form of human KIF5A
  • GenBank ID
    BC146670
  • Entrez Gene
    KIF5A (a.k.a. ALS25, D12S1889, MY050, NEIMY, NKHC, SPG10)
  • Promoter polyhedrin
  • Tag / Fusion Protein
    • mScarlet-2xStrepII (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGATTATTCATACCGTCCCA
  • 3′ sequencing primer CAAATGTGGTATGGCTGATT
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    KLC1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1680
  • GenBank ID
    BC008881
  • Entrez Gene
    KLC1 (a.k.a. KLC, KNS2, KNS2A)
  • Promoter p10
  • Tag / Fusion Protein
    • His-FLAG (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGGACCTTTAATTCAACCCA
  • 3′ sequencing primer AGCGCGGGTTCCTTCCGGTATTGTC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSN840 was a gift from Kyoko Chiba (Addgene plasmid # 184832 ; http://n2t.net/addgene:184832 ; RRID:Addgene_184832)
  • For your References section:

    An ALS-associated KIF5A mutant forms oligomers and aggregates and induces neuronal toxicity. Nakano J, Chiba K, Niwa S. Genes Cells. 2022 Apr 17. doi: 10.1111/gtc.12936. 10.1111/gtc.12936 PubMed 35430760