pSN840
(Plasmid #184832)

• Purpose: Expresses human KIF5A(∆exon27) and human KLC1 in insect cells
• Depositing Lab: Kyoko Chiba
• Publication: Nakano et al Genes Cells. 2022 Apr 17. doi: 10.1111/gtc.12936.

Backbone

• Vector backbone: pACEBac1, pIDS
• Backbone manufacturer: GENEVA Biotech
• Backbone size w/o insert (bp): 5944
• Total vector size (bp): 10735
• Modifications to backbone: Generated by Cre-LoxP recombination of pACEBac1 and pIDS
• Vector type: Insect Expression, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Gentamicin, 10 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: KIF5A (∆exon27)
• Species: H. sapiens (human)
• Insert Size (bp): 3111
• Mutation: ∆exon27 form of human KIF5A
• GenBank ID: BC146670
• Entrez Gene: KIF5A (a.k.a. ALS25, D12S1889, MY050, NEIMY, NKHC, SPG10)
• Promoter: polyhedrin
• Tag / Fusion Protein:
  • mScarlet-2xStrepII (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GGATTATTCATACCGTCCCA
• 3′ sequencing primer: CAAATGTGGTATGGCTGATT

Gene/Insert 2

• Gene/Insert name: KLC1
• Species: H. sapiens (human)
• Insert Size (bp): 1680
• GenBank ID: BC008881
• Entrez Gene: KLC1 (a.k.a. KLC, KNS2, KNS2A)
• Promoter: p10
• Tag / Fusion Protein:
  • His-FLAG (N terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGGACCTTTAATTCAACCCA
• 3′ sequencing primer: AGCGCGGGTTCCTTCCGGTATTGTC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry