pSN837
(Plasmid
#184825)
-
PurposeExpresses human KIF5A in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 184825 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepmScarlet_C1
-
Backbone manufacturerAddgene #85042
- Backbone size w/o insert (bp) 4761
- Total vector size (bp) 7857
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKIF5A
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3096
-
GenBank IDBC146670
-
Entrez GeneKIF5A (a.k.a. ALS25, D12S1889, MY050, NEIMY, NKHC, SPG10)
- Promoter CMV
-
Tag
/ Fusion Protein
- mScarlet (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer GAAATTTGTGATGCTATTGC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSN837 was a gift from Kyoko Chiba (Addgene plasmid # 184825 ; http://n2t.net/addgene:184825 ; RRID:Addgene_184825) -
For your References section:
An ALS-associated KIF5A mutant forms oligomers and aggregates and induces neuronal toxicity. Nakano J, Chiba K, Niwa S. Genes Cells. 2022 Apr 17. doi: 10.1111/gtc.12936. 10.1111/gtc.12936 PubMed 35430760
