pFS_1061_pET30_pCat-tetR-Term-ptetA-FsRT-Cas1(opt)-Cas2(opt)-3xTerm_GGC(BbsI)-Leader-ARRAY2-DR2-FaqI_Term_NotI
(Plasmid
#184738)
-
Purposeencodes aTc inducible FsRT-Cas1–Cas2 and transcriptionally insulated FsCRISPR Array 2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 184738 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET30b+
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 3700
- Total vector size (bp) 6600
-
Modifications to backboneremoval of BbsI restriction sites
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameFsRT-Cas1(opt)-Cas2(opt)
-
SpeciesFusicatenibacter Saccharivorans
-
Insert Size (bp)2200
-
Mutationsequence codon optimized for expression in E. coli
- Promoter pTetA
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (unknown if destroyed)
- 5′ sequencing primer CCTTTCTGCGTTTATATACTAGAGTC (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFS_1061_pET30_pCat-tetR-Term-ptetA-FsRT-Cas1(opt)-Cas2(opt)-3xTerm_GGC(BbsI)-Leader-ARRAY2-DR2-FaqI_Term_NotI was a gift from Randall Platt (Addgene plasmid # 184738 ; http://n2t.net/addgene:184738 ; RRID:Addgene_184738) -
For your References section:
Noninvasive assessment of gut function using transcriptional recording sentinel cells. Schmidt F, Zimmermann J, Tanna T, Farouni R, Conway T, Macpherson AJ, Platt RJ. Science. 2022 May 13;376(6594):eabm6038. doi: 10.1126/science.abm6038. Epub 2022 May 13. 10.1126/science.abm6038 PubMed 35549411