Skip to main content
Addgene

pCW-OVOL2-HA
(Plasmid #184737)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 184737 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCW empty vector (Addgene plasmid #184708)
  • Backbone size w/o insert (bp) 7600
  • Total vector size (bp) 8500
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ovo like zinc finger 2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    876
  • GenBank ID
    58495
  • Entrez Gene
    OVOL2 (a.k.a. CHED, CHED1, CHED2, EUROIMAGE566589, PPCD1, ZNF339)
  • Promoter Tet ON
  • Tag / Fusion Protein
    • HA (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer AGCTCGTTTAGTGAACCGTCAGATC
  • 3′ sequencing primer CACATTCTTCACGTCCGTTC
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    human OVOL2-HA was cloned from plasmid MSCV-OVOL2-HA (Manzotti et al. DOI:10.1158/1078-0432.CCR-18-2364)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCW-OVOL2-HA was a gift from Alessia Ciarrocchi & Gloria Manzotti (Addgene plasmid # 184737 ; http://n2t.net/addgene:184737 ; RRID:Addgene_184737)

  • For your References section:

    OVOL2 impairs RHO GTPase signaling to restrain mitosis and aggressiveness of Anaplastic Thyroid Cancer. Gugnoni M, Manzotti G, Vitale E, Sauta E, Torricelli F, Reggiani F, Pistoni M, Piana S, Ciarrocchi A. J Exp Clin Cancer Res. 2022 Mar 25;41(1):108. doi: 10.1186/s13046-022-02316-2. 10.1186/s13046-022-02316-2 PubMed 35337349
Related items:
Commonly requested with: