pCW empty vector
(Plasmid #184708)

• Purpose: (Empty Backbone) Lentiviral empty vector for doxycycline-inducible expression
• Depositing Labs: Alessia Ciarrocchi, Gloria Manzotti
• Publication: Gugnoni et al J Exp Clin Cancer Res. 2022 Mar 25;41(1):108. doi: 10.1186/s13046-022-02316-2.

Backbone

• Vector backbone: pCW-Cas9
• Backbone size (bp): 7600
• Modifications to backbone: Removed insert (humanized S. pyogenes Cas9)
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: AGCTCGTTTAGTGAACCGTCAGATC
• 3′ sequencing primer: CACATTCTTCACGTCCGTTC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Eric Lander & David Sabatini (Cas9 was removed from Addgene plasmid #50661 and MCS was inserted).
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid was derived from the lentiviral vector pCW-Cas9 ( Eric Lander & David Sabatini, Addgene plasmid #50661).
Cas9 insert was removed and substituted by a Multiple Cloning Site harbouring the following restriction sites: NheI - EcoRI - HpaI - MluI - BamHI.