Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pKLV2-EF1a-GFP RanSen
(Plasmid #184697)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 184697 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pKLV2-EF1a-BsdCas9-W
  • Backbone manufacturer
    Addgene
  • Backbone size w/o insert (bp) 7953
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GFP RanSen
  • Species
    Synthetic
  • Insert Size (bp)
    1524
  • Promoter EF1a

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKLV2-EF1a-GFP RanSen was a gift from Brian Van Tine (Addgene plasmid # 184697 ; http://n2t.net/addgene:184697 ; RRID:Addgene_184697)
  • For your References section:

    Intracellular arginine-dependent translation sensor reveals the dynamics of arginine starvation response and resistance in ASS1-negative cells. Rogers LC, Zhou J, Baker A, Schutt CR, Panda PK, Van Tine BA. Cancer Metab. 2021 Jan 21;9(1):4. doi: 10.1186/s40170-021-00238-9. 10.1186/s40170-021-00238-9 PubMed 33478587