Skip to main content
Addgene

pKLV2-EF1a-GFP ArgSen delta Disordered Region
(Plasmid #184693)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 184693 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pKLV2-EF1a-BsdCas9-W
  • Backbone manufacturer
    Addgene
  • Backbone size w/o insert (bp) 7953
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GFP ArgSen delta Disordered Region
  • Species
    Synthetic
  • Insert Size (bp)
    1194
  • Promoter EF1a

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAAC
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKLV2-EF1a-GFP ArgSen delta Disordered Region was a gift from Brian Van Tine (Addgene plasmid # 184693 ; http://n2t.net/addgene:184693 ; RRID:Addgene_184693)

  • For your References section:

    Intracellular arginine-dependent translation sensor reveals the dynamics of arginine starvation response and resistance in ASS1-negative cells. Rogers LC, Zhou J, Baker A, Schutt CR, Panda PK, Van Tine BA. Cancer Metab. 2021 Jan 21;9(1):4. doi: 10.1186/s40170-021-00238-9. 10.1186/s40170-021-00238-9 PubMed 33478587
Related items: