pKLV2-EF1a-GFP ArgSen delta Degradation Domain
(Plasmid
#184692)
-
PurposeLentiviral transfer plasmid for expression of GFP ArgSen delta Degradation Domain
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 184692 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepKLV2-EF1a-BsdCas9-W
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 7953
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGFP ArgSen delta Degradation Domain
-
SpeciesSynthetic
-
Insert Size (bp)942
- Promoter EF1a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer CATAGCGTAAAAGGAGCAAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKLV2-EF1a-GFP ArgSen delta Degradation Domain was a gift from Brian Van Tine (Addgene plasmid # 184692 ; http://n2t.net/addgene:184692 ; RRID:Addgene_184692) -
For your References section:
Intracellular arginine-dependent translation sensor reveals the dynamics of arginine starvation response and resistance in ASS1-negative cells. Rogers LC, Zhou J, Baker A, Schutt CR, Panda PK, Van Tine BA. Cancer Metab. 2021 Jan 21;9(1):4. doi: 10.1186/s40170-021-00238-9. 10.1186/s40170-021-00238-9 PubMed 33478587