Skip to main content
Addgene

pLPC-MYC.Mm.EPC2
(Plasmid #184654)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 184654 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLPC
  • Backbone size w/o insert (bp) 5727
  • Total vector size (bp) 8140
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Epc2
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Epc2 (a.k.a. 5830499L14, D2Ertd694e)
  • Promoter CMV
  • Tag / Fusion Protein
    • MYC (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer GATCTAGTAAACTCTCCTTCCGAGC
  • 3′ sequencing primer AAGCTAGCTTGCCAAACCTACAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLPC-MYC.Mm.EPC2 was a gift from Agnel Sfeir (Addgene plasmid # 184654 ; http://n2t.net/addgene:184654 ; RRID:Addgene_184654)
  • For your References section:

    Rap1 regulates TIP60 function during fate transition between two-cell-like and pluripotent states. Barry RM, Sacco O, Mameri A, Stojaspal M, Kartsonis W, Shah P, De Ioannes P, Hofr C, Cote J, Sfeir A. Genes Dev. 2022 Feb 24. pii: gad.349039.121. doi: 10.1101/gad.349039.121. 10.1101/gad.349039.121 PubMed 35210222