pAAV-CAG-LiLac
(Plasmid #184570)

• Purpose: Fluorescent reporter for lactate (with lifetime and intensity response); expresses in mammalian cells and can be packaged as AAV
• Depositing Lab: Gary Yellen
• Publication: Koveal et al Nat Commun. 2022 May 25;13(1):2919. doi: 10.1038/s41467-022-30685-x.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV-CAG
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: LiLac fluorescent sensor of lactate
• Species: Synthetic
• Insert Size (bp): 1557
• Promoter: CAG
• Tag / Fusion Protein:
  • His7 (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCAACGTGCTGGTTATTGTG
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Resource Information

• Supplemental Documents:
  • 184570 pAAV-CAG-LiLac.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

mTurquoise2 sequences are originally from Goedhart, J. et al. Structure-guided evolution of cyan fluorescent proteins towards a quantum yield of 93%. Nat Commun 3, 751 (2012) and were obtained by PCR from the plasmid encoding the Lck-cpmTq2-Calcium-lifetime-sensor (Addgene plasmid #129627) (A turquoise fluorescence lifetime-based biosensor for quantitative imaging of intracellular calcium. van der Linden FH, Mahlandt EK, Arts JJG, Beumer J, Puschhof J, de Man SMA, Chertkova AO, Ponsioen B, Clevers H, van Buul JD, Postma M, Gadella TWJ Jr, Goedhart J. Nat Commun. 2021 Dec 9;12(1):7159. doi: 10.1038/s41467-021-27249-w.)