pAAV-CAG-LiLac
(Plasmid #184570)

• Purpose: Fluorescent reporter for lactate (with lifetime and intensity response); expresses in mammalian cells and can be packaged as AAV
• Depositing Lab: Gary Yellen
• Publication: Koveal et al Nat Commun. 2022 May 25;13(1):2919. doi: 10.1038/s41467-022-30685-x.

Backbone

• Vector backbone: pAAV-CAG
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: LiLac fluorescent sensor of lactate
• Species: Synthetic
• Insert Size (bp): 1557
• Promoter: CAG
• Tag / Fusion Protein:
  • His7 (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GCAACGTGCTGGTTATTGTG
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Resource Information

• Supplemental Documents:
  • 184570 pAAV-CAG-LiLac.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

mTurquoise2 sequences are originally from Goedhart, J. et al. Structure-guided evolution of cyan fluorescent proteins towards a quantum yield of 93%. Nat Commun 3, 751 (2012) and were obtained by PCR from the plasmid encoding the Lck-cpmTq2-Calcium-lifetime-sensor (Addgene plasmid #129627) (A turquoise fluorescence lifetime-based biosensor for quantitative imaging of intracellular calcium. van der Linden FH, Mahlandt EK, Arts JJG, Beumer J, Puschhof J, de Man SMA, Chertkova AO, Ponsioen B, Clevers H, van Buul JD, Postma M, Gadella TWJ Jr, Goedhart J. Nat Commun. 2021 Dec 9;12(1):7159. doi: 10.1038/s41467-021-27249-w.)