pPbuCas13b-gRNA-NT
(Plasmid #184568)

• Purpose: Constitutive expression of single-spacer CRISPR array with non-targeting spacer for PbuCas13b in bacteria.
• Depositing Lab: Chase Beisel
• Publication: Wandera et al Mol Cell. 2022 May 24. pii: S1097-2765(22)00437-3. doi: 10.1016/j.molcel.2022.05.003.

Backbone

• Vector backbone: pACYC184
• Backbone size w/o insert (bp): 4218
• Total vector size (bp): 4360
• Modifications to backbone: inserted single-spacer array including promoter in the tetracycline gene
• Vector type: Bacterial Expression, CRISPR, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Constitutive expression of single-spacer CRISPR array witha nontargeting spacer for PbuCas13b in bacteria.
• gRNA/shRNA sequence: CTCGTATGTTGTGTGGAATTGTGAGCGGAT
• Species: Prevotella buccae
• Promoter: J23119

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsaI (destroyed during cloning)
• 3′ cloning site: BsaI (destroyed during cloning)
• 5′ sequencing primer: gaaccttcgaaaaaccgccc
• 3′ sequencing primer: gacatcaccgatggggaagat

Resource Information

• Supplemental Documents:
  • cbs-1323-p15a-pbcas13b-spacer-nt.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry