K-to-R mutant NPRL3(1-569) in pLJM60, codon-optimized
(Plasmid
#184563)
-
PurposeCMV-driven expression of an untagged mutant NPRL3 (core subunit of GATOR1) — codon-optimized sequence for stable expression in mammalian cells. All lysine residues were mutated to arginines.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 184563 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLJM60 (based on pLKO.1 and Lentihair)
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameC16orf35, CGTHBA, FFEVF3, HS-40, MARE, NPR3, RMD11
-
Alt nameNPR3 like, GATOR1 complex subunit
-
Alt nameNitrogen permease regulator 3-like protein
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1710
-
MutationAll lysines were mutated to arginines. Codon-optimized for expression in human cells.
-
GenBank IDNM_001077350
-
Entrez GeneNPRL3 (a.k.a. C16orf35, CGTHBA, FFEVF3, HS-40, MARE, NPR3, RMD11)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer (1) CMV Forward, (2) SP6
- 3′ sequencing primer TAGTTTGTATGTCTGTTGCTATTA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
K-to-R mutant NPRL3(1-569) in pLJM60, codon-optimized was a gift from Kacper Rogala (Addgene plasmid # 184563 ; http://n2t.net/addgene:184563 ; RRID:Addgene_184563) -
For your References section:
Structure of the nutrient-sensing hub GATOR2. Valenstein ML, Rogala KB, Lalgudi PV, Brignole EJ, Gu X, Saxton RA, Chantranupong L, Kolibius J, Quast JP, Sabatini DM. Nature. 2022 Jul;607(7919):610-616. doi: 10.1038/s41586-022-04939-z. Epub 2022 Jul 13. 10.1038/s41586-022-04939-z PubMed 35831510