K-to-R mutant NPRL3(1-569) in pLJM60, codon-optimized
(Plasmid #184563)

• Purpose: CMV-driven expression of an untagged mutant NPRL3 (core subunit of GATOR1) — codon-optimized sequence for stable expression in mammalian cells. All lysine residues were mutated to arginines.
• Depositing Lab: Kacper Rogala
• Publication: Valenstein et al Nature. 2022 Jul;607(7919):610-616. doi: 10.1038/s41586-022-04939-z. Epub 2022 Jul 13.

Backbone

• Vector backbone: pLJM60 (based on pLKO.1 and Lentihair)
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: C16orf35, CGTHBA, FFEVF3, HS-40, MARE, NPR3, RMD11
• Alt name: NPR3 like, GATOR1 complex subunit
• Alt name: Nitrogen permease regulator 3-like protein
• Species: H. sapiens (human)
• Insert Size (bp): 1710
• Mutation: All lysines were mutated to arginines. Codon-optimized for expression in human cells.
• GenBank ID: NM_001077350
• Entrez Gene: NPRL3 (a.k.a. C16orf35, CGTHBA, FFEVF3, HS-40, MARE, NPR3, RMD11)
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: (1) CMV Forward, (2) SP6
• 3′ sequencing primer: TAGTTTGTATGTCTGTTGCTATTA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry