Skip to main content
Addgene

K-to-R mutant NPRL2(1-380) in pLJM60
(Plasmid #184562)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 184562 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pLJM60 (based on pLKO.1 and Lentihair)
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NPRL2
  • Alt name
    NPR2 like, GATOR1 complex subunit
  • Alt name
    Nitrogen permease regulator 2-like protein
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1143
  • Mutation
    All lysines were mutated to arginines.
  • GenBank ID
    NM_006545
  • Entrez Gene
    NPRL2 (a.k.a. FFEVF2, NPR2, NPR2L, TUSC4)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer (1) CMV Forward, (2) SP6
  • 3′ sequencing primer TAGTTTGTATGTCTGTTGCTATTA
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    K-to-R mutant NPRL2(1-380) in pLJM60 was a gift from Kacper Rogala (Addgene plasmid # 184562 ; http://n2t.net/addgene:184562 ; RRID:Addgene_184562)

  • For your References section:

    Structure of the nutrient-sensing hub GATOR2. Valenstein ML, Rogala KB, Lalgudi PV, Brignole EJ, Gu X, Saxton RA, Chantranupong L, Kolibius J, Quast JP, Sabatini DM. Nature. 2022 Jul;607(7919):610-616. doi: 10.1038/s41586-022-04939-z. Epub 2022 Jul 13. 10.1038/s41586-022-04939-z PubMed 35831510
Related items: