Skip to main content
Addgene

pLV hU6-sgKRAS hUbC-dCas9-KRAB-T2a-GFP2
(Plasmid #184557)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 184557 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-GFP
  • Backbone manufacturer
    addgene
  • Backbone size w/o insert (bp) 14981
  • Total vector size (bp) 15001
  • Modifications to backbone
    KRAS sgRNA is inserted into the position of BsmBI
  • Vector type
    Bacterial Expression, Mouse Targeting, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Kirsten rat sarcoma virus
  • Alt name
    KRAS
  • gRNA/shRNA sequence
    CGGCTGAGGCGGCAGCGCTG
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Kras (a.k.a. K-Ras, K-Ras 2, K-ras, Ki-ras, Kras-2, Kras2, c-K-ras, c-Ki-ras, p21B, ras)
  • Tag / Fusion Protein
    • Flag (N terminal on insert)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV hU6-sgKRAS hUbC-dCas9-KRAB-T2a-GFP2 was a gift from Sandeep Prabhu (Addgene plasmid # 184557 ; http://n2t.net/addgene:184557 ; RRID:Addgene_184557)

  • For your References section:

    Activation of GPR44 decreases severity of myeloid leukemia via specific targeting of leukemia initiating stem cells. Qian F, Nettleford SK, Zhou J, Arner BE, Hall MA, Sharma A, Annageldiyev C, Rossi RM, Tukaramrao DB, Sarkar D, Hegde S, Gandhi UH, Finch ER, Goodfield L, Quickel MD, Claxton DF, Paulson RF, Prabhu KS. Cell Rep. 2023 Jul 25;42(7):112794. doi: 10.1016/j.celrep.2023.112794. Epub 2023 Jul 18. 10.1016/j.celrep.2023.112794 PubMed 37459233
Related items: