pLV hU6-sgKRAS hUbC-dCas9-KRAB-T2a-GFP2
(Plasmid
#184557)
-
PurposeKnockdown of murine KRAS gene by targeting the promoter region via CRISPRi system
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 184557 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLV hU6-sgRNA hUbC-dCas9-KRAB-T2a-GFP
-
Backbone manufactureraddgene
- Backbone size w/o insert (bp) 14981
- Total vector size (bp) 15001
-
Modifications to backboneKRAS sgRNA is inserted into the position of BsmBI
-
Vector typeBacterial Expression, Mouse Targeting, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKirsten rat sarcoma virus
-
Alt nameKRAS
-
gRNA/shRNA sequenceCGGCTGAGGCGGCAGCGCTG
-
SpeciesM. musculus (mouse)
-
Entrez GeneKras (a.k.a. K-Ras, K-Ras 2, K-ras, Ki-ras, Kras-2, Kras2, c-K-ras, c-Ki-ras, p21B, ras)
-
Tag
/ Fusion Protein
- Flag (N terminal on insert)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV hU6-sgKRAS hUbC-dCas9-KRAB-T2a-GFP2 was a gift from Sandeep Prabhu (Addgene plasmid # 184557 ; http://n2t.net/addgene:184557 ; RRID:Addgene_184557) -
For your References section:
Activation of GPR44 decreases severity of myeloid leukemia via specific targeting of leukemia initiating stem cells. Qian F, Nettleford SK, Zhou J, Arner BE, Hall MA, Sharma A, Annageldiyev C, Rossi RM, Tukaramrao DB, Sarkar D, Hegde S, Gandhi UH, Finch ER, Goodfield L, Quickel MD, Claxton DF, Paulson RF, Prabhu KS. Cell Rep. 2023 Jul 25;42(7):112794. doi: 10.1016/j.celrep.2023.112794. Epub 2023 Jul 18. 10.1016/j.celrep.2023.112794 PubMed 37459233