Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

shTRIP13-2
(Plasmid #184537)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 184537 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLKO.5
  • Backbone manufacturer
    Broad Institute
  • Vector type
    Mammalian Expression, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TRIP13
  • gRNA/shRNA sequence
    GCACTGTTGCACTTCACATTT
  • Species
    H. sapiens (human)
  • Entrez Gene
    TRIP13 (a.k.a. 16E1BP, MVA3, OOMD9, OZEMA9)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer GATACAAGGCTGTTAGAGAGATAATT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    shTRIP13-2 was a gift from Andrew Hong (Addgene plasmid # 184537 ; http://n2t.net/addgene:184537 ; RRID:Addgene_184537)
  • For your References section:

    Targeting TRIP13 in favorable histology Wilms tumor with nuclear export inhibitors synergizes with doxorubicin. Mittal K, Cooper GW, Lee BP, Su Y, Skinner KT, Shim J, Jonus HC, Kim WJ, Doshi M, Almanza D, Kynnap BD, Christie AL, Yang X, Cowley GS, Leeper BA, Morton CL, Dwivedi B, Lawrence T, Rupji M, Keskula P, Meyer S, Clinton CM, Bhasin M, Crompton BD, Tseng YY, Boehm JS, Ligon KL, Root DE, Murphy AJ, Weinstock DM, Gokhale PC, Spangle JM, Rivera MN, Mullen EA, Stegmaier K, Goldsmith KC, Hahn WC, Hong AL. Commun Biol. 2024 Apr 8;7(1):426. doi: 10.1038/s42003-024-06140-6. 10.1038/s42003-024-06140-6 PubMed 38589567