shTRIP13-1
(Plasmid
#184536)
-
PurposeshRNA expression vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 184536 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLKO.5
-
Backbone manufacturerBroad Institute
-
Vector typeMammalian Expression, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTRIP13
-
gRNA/shRNA sequenceCGATTATGTGATGACAACTTT
-
SpeciesH. sapiens (human)
-
Entrez GeneTRIP13 (a.k.a. 16E1BP, MVA3, OOMD9, OZEMA9)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer GATACAAGGCTGTTAGAGAGATAATT (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
shTRIP13-1 was a gift from Andrew Hong (Addgene plasmid # 184536 ; http://n2t.net/addgene:184536 ; RRID:Addgene_184536) -
For your References section:
Targeting TRIP13 in favorable histology Wilms tumor with nuclear export inhibitors synergizes with doxorubicin. Mittal K, Cooper GW, Lee BP, Su Y, Skinner KT, Shim J, Jonus HC, Kim WJ, Doshi M, Almanza D, Kynnap BD, Christie AL, Yang X, Cowley GS, Leeper BA, Morton CL, Dwivedi B, Lawrence T, Rupji M, Keskula P, Meyer S, Clinton CM, Bhasin M, Crompton BD, Tseng YY, Boehm JS, Ligon KL, Root DE, Murphy AJ, Weinstock DM, Gokhale PC, Spangle JM, Rivera MN, Mullen EA, Stegmaier K, Goldsmith KC, Hahn WC, Hong AL. Commun Biol. 2024 Apr 8;7(1):426. doi: 10.1038/s42003-024-06140-6. 10.1038/s42003-024-06140-6 PubMed 38589567