pEGFP-N1-HSD17B13-WT-FLAGC
(Plasmid
#184501)
-
PurposeExpresses human HSD17B13 with a C-terminal FLAG-GFP tag. Confers G418 resistance.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 184501 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGFP-N1-FLAGC
-
Backbone manufacturerAddgene #60360
- Backbone size w/o insert (bp) 4718
- Total vector size (bp) 5623
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name17-beta-hydroxysteroid dehydrogenase 13
-
Alt nameSDR16C3
-
SpeciesH. sapiens (human)
-
Entrez GeneHSD17B13 (a.k.a. HMFN0376, NIIL497, SCDR9, SDR16C3)
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAGC-GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site MluI (not destroyed)
- 5′ sequencing primer SEQ-CMV-F (GTAGGCGTGTACGGTGGGAGG)
- 3′ sequencing primer SEQ-GFPN-R (CTCCTCGCCCTTGCTCACC) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byIMAGE clone #8327771
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-N1-HSD17B13-WT-FLAGC was a gift from Sébastien Britton (Addgene plasmid # 184501 ; http://n2t.net/addgene:184501 ; RRID:Addgene_184501) -
For your References section:
SDR enzymes oxidize specific lipidic alkynylcarbinols into cytotoxic protein-reactive species. Demange P, Joly E, Marcoux J, Zanon PRA, Listunov D, Rulliere P, Barthes C, Noirot C, Izquierdo JB, Rozie A, Pradines K, Hee R, de Brito MV, Marcellin M, Serre RF, Bouchez O, Burlet-Schiltz O, Oliveira MCF, Ballereau S, Bernardes-Genisson V, Maraval V, Calsou P, Hacker SM, Genisson Y, Chauvin R, Britton S. Elife. 2022 May 10;11. pii: 73913. doi: 10.7554/eLife.73913. 10.7554/eLife.73913 PubMed 35535493