Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEGFP-N1-HSD17B13-WT-FLAGC
(Plasmid #184501)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 184501 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP-N1-FLAGC
  • Backbone manufacturer
    Addgene #60360
  • Backbone size w/o insert (bp) 4718
  • Total vector size (bp) 5623
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    17-beta-hydroxysteroid dehydrogenase 13
  • Alt name
    SDR16C3
  • Species
    H. sapiens (human)
  • Entrez Gene
    HSD17B13 (a.k.a. HMFN0376, NIIL497, SCDR9, SDR16C3)
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAGC-GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer SEQ-CMV-F (GTAGGCGTGTACGGTGGGAGG)
  • 3′ sequencing primer SEQ-GFPN-R (CTCCTCGCCCTTGCTCACC)
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    IMAGE clone #8327771

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-N1-HSD17B13-WT-FLAGC was a gift from Sébastien Britton (Addgene plasmid # 184501 ; http://n2t.net/addgene:184501 ; RRID:Addgene_184501)
  • For your References section:

    SDR enzymes oxidize specific lipidic alkynylcarbinols into cytotoxic protein-reactive species. Demange P, Joly E, Marcoux J, Zanon PRA, Listunov D, Rulliere P, Barthes C, Noirot C, Izquierdo JB, Rozie A, Pradines K, Hee R, de Brito MV, Marcellin M, Serre RF, Bouchez O, Burlet-Schiltz O, Oliveira MCF, Ballereau S, Bernardes-Genisson V, Maraval V, Calsou P, Hacker SM, Genisson Y, Chauvin R, Britton S. Elife. 2022 May 10;11. pii: 73913. doi: 10.7554/eLife.73913. 10.7554/eLife.73913 PubMed 35535493